View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8330_high_2 (Length: 380)
Name: NF8330_high_2
Description: NF8330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8330_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 209 - 371
Target Start/End: Original strand, 18110477 - 18110639
Alignment:
| Q |
209 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110477 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
18110576 |
T |
|
| Q |
309 |
cagaattcctccaaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcttctca |
371 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110577 |
cagaattcctcccaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcttctca |
18110639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 18110286 - 18110415
Alignment:
| Q |
18 |
atctatagagagaaccaaaacacaaacaaatgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaat |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110286 |
atctatagagagaaccaaagcacaaacaaatgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaat |
18110385 |
T |
|
| Q |
118 |
ttagaggaaaagatagtaggaatgagtgct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18110386 |
ttagaggaaaagatagtaggaatgagtgct |
18110415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University