View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8331_low_17 (Length: 220)
Name: NF8331_low_17
Description: NF8331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8331_low_17 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 18269947 - 18270166
Alignment:
| Q |
1 |
aatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgaatcatggtggctagaagcgataaaagtagttgaggaagtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18269947 |
aatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgattcatggtggctagaagcgataaaagtagttgaggaagtgg |
18270046 |
T |
|
| Q |
101 |
agaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggactgaagccctatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270047 |
agaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggactgaagccctatcc |
18270146 |
T |
|
| Q |
201 |
cctttatttagacggcatag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18270147 |
cctttatttagacggcatag |
18270166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University