View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8333_high_6 (Length: 329)
Name: NF8333_high_6
Description: NF8333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8333_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 39774698 - 39775010
Alignment:
| Q |
1 |
actgacatcattcataacacgttgcccattttctaaagtgtttattacattctaatattggtgagtataaaatctaatgcatgtactgttttattgcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39774698 |
actgacatcattcataacacgttgcccattttctaaagtgtttattacattctaatcttggtgagtataaaatgtaatgcatgtactgttttattgcagt |
39774797 |
T |
 |
| Q |
101 |
ggcagggaaatcaaatgtgacacacagttttcaccttgatttcatgcaaataatatagtataggttaaaattttggcatggcatagatatacgacaaatt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39774798 |
ggcagggaaatcaaatgcgacacacagtttttaccttgatttcatgcaaataatatagtataggttaaaattttggcatggcatagatatacgacaaatt |
39774897 |
T |
 |
| Q |
201 |
caagtctttacacagtcaaatttcaggtttagtgtccaagatctcttcataaatgctagcttcactcactctcttactcacagttttgttgtagaaaact |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39774898 |
caagtctttacacagtcaaatttcaagtttagtgtccaagatctcttcataaatgctagcttcactcactctcttactcacagttttgttgtagaaaact |
39774997 |
T |
 |
| Q |
301 |
aatatcaatatgg |
313 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
39774998 |
aatatcactatgg |
39775010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University