View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8333_low_12 (Length: 249)
Name: NF8333_low_12
Description: NF8333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8333_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 11 - 121
Target Start/End: Original strand, 316583 - 316693
Alignment:
| Q |
11 |
ttattcttagttgtcaaaagtgactgcttcatatggatgaatattactattcattagtaaagtccaaagtaacacaaatttctcaaaaatattctcaagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
316583 |
ttattcttagttgtcaaaagtgactgcttcatatggatgaatattactattcattagtaaagtccaaagtaacacaaatttctcaaaaatattctcaagg |
316682 |
T |
 |
| Q |
111 |
cattaaccata |
121 |
Q |
| |
|
||||||||||| |
|
|
| T |
316683 |
cattaaccata |
316693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 118 - 232
Target Start/End: Original strand, 316766 - 316880
Alignment:
| Q |
118 |
cataaacacttgtgacacgattcgagagaatctagagaaataaattatgacatatgtaagcnnnnnnnagcttatttgcagaagatttcaaggataactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
316766 |
cataaacacttgtgacacgattcgagagaatctagagaaataaattatgacatatgtaagctttttttagcttatttgcagaagatttcaaggataactt |
316865 |
T |
 |
| Q |
218 |
atgaaaacaacttat |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
316866 |
atgaaaacaacttat |
316880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University