View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8334_low_14 (Length: 310)
Name: NF8334_low_14
Description: NF8334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8334_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 11 - 293
Target Start/End: Complemental strand, 5352400 - 5352118
Alignment:
| Q |
11 |
gcagaacctgtgaggtttatacccgaggctgtttctgttattattcaagttaaagtctcatttgataggcttaacacttttctgtttgatgatgagataa |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5352400 |
gcagaacctgtgaggtttatacccgaagctgtttctgttattattcaagttaaagtctcatttgataggcttaacatttttctgtttgatgatgagataa |
5352301 |
T |
|
| Q |
111 |
atacttcctaccaaaagaagagcatttatgtttcaaaatcaggtaaatgcattgagatagaggaagctgatttcagctgggatgagggatcagttacacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5352300 |
atacttcctaccaaaagaagagcatttatgtttcaaaatcaggtaaatgcattgagatagaggaagctgatttcagttgggatgagggatcagttacacc |
5352201 |
T |
|
| Q |
211 |
tactttgagacaaattaatttcggcatcaaacatggtgaaaaagttgcagtttgtggaccagttggggctggcaagtcttctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352200 |
tactttgagacaaattaatttcggcatcaaacatggtgaaaaagttgcagtttgtggaccagttggggctggcaagtcttctt |
5352118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University