View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8334_low_15 (Length: 309)
Name: NF8334_low_15
Description: NF8334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8334_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 12275953 - 12276230
Alignment:
| Q |
19 |
ccatcaactccggatttttcagatcaagtttcttgtttcaaattcgttctcaaatctagtttgtccttcacggaatctcctttcctccttcataactcgc |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
12275953 |
ccatcaactccggattttccagatcaagtttcttgttttaaatttgttctcaaatctagtttgtcctttagggaatctccttgcctccttcataactcgc |
12276052 |
T |
|
| Q |
119 |
accaattttgtggtgttgttggtcctagttttctaggggaccagtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagt |
218 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276053 |
accaattttgtggtggtgtaggtcctagttttctaggtgactagtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagt |
12276152 |
T |
|
| Q |
219 |
tggttgtggaaccgtgatcgtgtaggcgaacggtttcaccgccattatgcaaagagttaagtttgtatgaatttgtct |
296 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276153 |
tggttttggaaccgtgattgtgttggcgaacgggttcaccgccattatgcaaagagttaagtttgtatgaatttgtct |
12276230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University