View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8334_low_17 (Length: 258)
Name: NF8334_low_17
Description: NF8334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8334_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 2241418 - 2241652
Alignment:
| Q |
12 |
tattattctcaccccctatacctgcacttcaaatatatatttttgaaaagnnnnnnnnn-----cactttttgcccttgcatgtaaaatatacttcttct |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2241418 |
tatttttctcaccccctatacctgcacttcaaatatatatttttgaaaagaaaaaaaaaaaaaacactttttgcccttgcatgtaaaatatacttcttct |
2241517 |
T |
 |
| Q |
107 |
tgataaaatggt-----attgaaaaatagtataattttgaaagagtcaaatatgtattactgtatcaactatcaagtacaaatagtaattgaaaagttac |
201 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2241518 |
tgataaaatggttaacaattgaaaaa---tataattttgaaagagtcaaatatgtattactgtatcaactatcaagtacaaagagtaattgaaaagttac |
2241614 |
T |
 |
| Q |
202 |
tttatagttggcaaccattagtgtaaatacctagctcc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2241615 |
tttatagttggcaaccattagtgtaaatacctagctcc |
2241652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University