View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8334_low_9 (Length: 350)
Name: NF8334_low_9
Description: NF8334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8334_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 28312628 - 28312326
Alignment:
| Q |
1 |
ggttattttgaaagagaatatattttgcaggagacagaacttgtactattaatcttggtggccaaacattaatgtgacgtatatgaaactatattgttta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28312628 |
ggttattttgaaagagaatatattt-gcaggagacagaacttgtactattaatcttggtggccaaacattaatgtggcgtatatgaaactatattgttta |
28312530 |
T |
|
| Q |
101 |
tatgagc-atatatattggcatctttctcagtcttggggacaattgagcgtttcatatatgccccgctatcacagtaat--gtggcccagttatactcca |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28312529 |
tatgagccatatatattggcatctttctcagtcttggggacaattgagcgtttcatatatgccccgctatcacagtaatatgtggcccagttatactcca |
28312430 |
T |
|
| Q |
198 |
ctccgacttgtcatttgtcaatgtttctaaatttggagaattatatgtgaacattcataatctcattgagatctcgagcgatgacgatgtgatatatatg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
28312429 |
ctccgacttgtcatttgtcaatgtttctaaatttggagaattatatgtggacattcataaactcattgagatctcaagcgatggcgatgtgataaatatg |
28312330 |
T |
|
| Q |
298 |
atat |
301 |
Q |
| |
|
|||| |
|
|
| T |
28312329 |
atat |
28312326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 334
Target Start/End: Complemental strand, 28312305 - 28312272
Alignment:
| Q |
301 |
tgagagatagagcgaaaataaaatgtagaatgtg |
334 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
28312305 |
tgagagatacagcgaaaataaaatgtagaatgtg |
28312272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University