View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8336_high_6 (Length: 219)
Name: NF8336_high_6
Description: NF8336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8336_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 28424159 - 28423974
Alignment:
| Q |
18 |
attttaaggccgttgacatctcaaataattggttctaattaaggtttttagattataaattaaggtaatcttagttggcaaagatttcattatagtttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28424159 |
attttaaggccgttgacatctcaaataattggttctaattaaggtttttagatcataaattaaggtaatcttagttggcaaagattttattatagtttgt |
28424060 |
T |
 |
| Q |
118 |
tgga--nnnnnnnngacggtcttctgttgaatcctctatacaatataaacttgttttagagagtgtttctctcttttccctttctc |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28424059 |
tggattttttttctgacggtcttctgttgaatcctctatacaatataaacttgttttagagagtgtagctctcttttccctttctc |
28423974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University