View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8336_low_1 (Length: 238)
Name: NF8336_low_1
Description: NF8336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8336_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 43218752 - 43218953
Alignment:
| Q |
18 |
agacaaacaatcagccctttgctaatttcaaccgtagcagtattcgttgaagatgaagccttgtgtgtgtaactgatatctaaattgtagtcttgccctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43218752 |
agacaaacaatcagccctttgctaatttcaaccatagcagtattcgttgaagatgaagccttgtgtgtgtaactgatatctaaatggtagtcttgccctt |
43218851 |
T |
|
| Q |
118 |
aggtttaagtcccgcccttagttttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43218852 |
aggtttaagtcccgcccttagttttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgat |
43218951 |
T |
|
| Q |
218 |
aa |
219 |
Q |
| |
|
|| |
|
|
| T |
43218952 |
aa |
43218953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 132 - 219
Target Start/End: Complemental strand, 43169495 - 43169408
Alignment:
| Q |
132 |
cccttagttttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgataa |
219 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43169495 |
cccttagttttgtataaaatatatgcttaatttatgagcaccggcatgtaaagattgcaaacattgtattatacaaaaaagttgataa |
43169408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 43169578 - 43169504
Alignment:
| Q |
18 |
agacaaacaatcagccctttgctaatttcaaccgtagcagtattcgttgaagatgaagccttgtgtgtgtaactg |
92 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
43169578 |
agacaaacaatgagccctttgctaatttcaaccgtagcagtatccgttgaagatgaagtcttgtgtctgtaactg |
43169504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University