View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8336_low_8 (Length: 254)
Name: NF8336_low_8
Description: NF8336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8336_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 2241423 - 2241652
Alignment:
| Q |
14 |
ttctcaccccctatacctgcacttcaaatatatatttttgaaaagnnnnnnnnnn----cactttttgcccttgcatgtaaaatatacttcttcttgata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2241423 |
ttctcaccccctatacctgcacttcaaatatatatttttgaaaagaaaaaaaaaaaaaacactttttgcccttgcatgtaaaatatacttcttcttgata |
2241522 |
T |
|
| Q |
110 |
aaatggt-----attgaaaaatagtataattttgaaagagtcaaatatgtattactgtatcaactatcaagtacaaatagtaattgaaaagttactttat |
204 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2241523 |
aaatggttaacaattgaaaaa---tataattttgaaagagtcaaatatgtattactgtatcaactatcaagtacaaagagtaattgaaaagttactttat |
2241619 |
T |
|
| Q |
205 |
agttggcaaccattagtgtaaatacctagctcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2241620 |
agttggcaaccattagtgtaaatacctagctcc |
2241652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University