View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8337_low_2 (Length: 241)
Name: NF8337_low_2
Description: NF8337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8337_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 29 - 199
Target Start/End: Complemental strand, 25523566 - 25523400
Alignment:
| Q |
29 |
cttcataatttttcataaactggttccatctagattttcccaattaaacttgttgtattaattaattgccatgcattagtttactactttccatgcacgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25523566 |
cttcataatttttcataaactggttccatctagattttcccaattaaaattgttgtattaatt----gccatgcattagtttactactttccatgcacgt |
25523471 |
T |
 |
| Q |
129 |
tttgcattctataaataaaaccatatatgaaactttctttttctctatcctatcttatcttgtgaacaatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25523470 |
tttgcattctataaataaaaccatatatgaaactttctttttctctatcctatcttatcttgtgaacaatc |
25523400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 25523611 - 25523583
Alignment:
| Q |
1 |
tccttaagccacacatgttgcacgtgtcc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25523611 |
tccttaagccacacatgttgcacgtgtcc |
25523583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University