View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8340_high_2 (Length: 369)
Name: NF8340_high_2
Description: NF8340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8340_high_2 |
 |  |
|
| [»] scaffold0127 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 195 - 358
Target Start/End: Complemental strand, 5536196 - 5536035
Alignment:
| Q |
195 |
agaaaaagttattttcttgtggagaactgaagacatcgcactaaaaattatttttctgcctctctctagaactttggtggtgcgaagatggcacatccat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||| || |||| |
|
|
| T |
5536196 |
agaaaaagttattttcttgtggagaactgaagacgtcgcactaaaaattatttttctgcctctcccta--actttggtggtgcgacgatggcccagccat |
5536099 |
T |
 |
| Q |
295 |
ccgcatcactcttcctacggcggcggttgtttgtatccgacggagaactatggtggctctctct |
358 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5536098 |
ccgcatcactcttcctacgacagtggttgtttgtatccgacggagaactatggtagctctctct |
5536035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 65 - 107
Target Start/End: Complemental strand, 5536324 - 5536282
Alignment:
| Q |
65 |
aagtgatgtattttgatgtgtgtctaaacaacatgatcaaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5536324 |
aagtgatgtattttgatgtgtgtctaaacaacatgatcaaatt |
5536282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 111
Target Start/End: Complemental strand, 5537182 - 5537141
Alignment:
| Q |
70 |
atgtattttgatgtgtgtctaaacaacatgatcaaatttgtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
5537182 |
atgtattttgatgtgtgtctaaacaatgtggtcaaatttgtg |
5537141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0127 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 22369 - 22335
Alignment:
| Q |
269 |
tggtggtgcgaagatggcacatccatccgcatcac |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22369 |
tggtggtgcgaagatggaacatccatccgcatcac |
22335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Original strand, 5745499 - 5745533
Alignment:
| Q |
269 |
tggtggtgcgaagatggcacatccatccgcatcac |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5745499 |
tggtggtgcgaagatggaacatccatccgcatcac |
5745533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University