View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8340_low_8 (Length: 216)
Name: NF8340_low_8
Description: NF8340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8340_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 49 - 201
Target Start/End: Original strand, 31679357 - 31679509
Alignment:
| Q |
49 |
tactacctcccgttaacattgctatgttgtactttgcaatttgcagggttgtgacagaagctgtttgtgattaccaatggtttgctcaactcaagcttta |
148 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31679357 |
tactacctcccgtgaacattgctatgttgtactttgcaatttgcagggttgtgacagaagctgtttgtgattaccaatggtttgctcaactcaagcttta |
31679456 |
T |
|
| Q |
149 |
tcccatatcatggaggcacgcctctacctcctcctattttatcgaagtataat |
201 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31679457 |
tcctatatcatggagacacgcctctacctcctcctattttatcgaagtgtaat |
31679509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 48
Target Start/End: Original strand, 31679145 - 31679175
Alignment:
| Q |
18 |
ctatcaaaaggaaaatcttccgctgattttt |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31679145 |
ctatcaaaaggaaaatcttccgctgattttt |
31679175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University