View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8341_low_15 (Length: 276)
Name: NF8341_low_15
Description: NF8341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8341_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 41674977 - 41675232
Alignment:
| Q |
18 |
agacgaaacccaacagctccgtcatcaagatgaagaagaagatgagggacgtttattatctagagagattgacgattttggttctcttgttgcctttcgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41674977 |
agacgaaacccaacagctccgtcatcaagatcaaga---agatgagggacgtttattatccagagagattgacgattttggttctcttgtttcctttcgc |
41675073 |
T |
 |
| Q |
118 |
ttgactcctcacaatgcctctgcctctgcctctggtatctattcctttccttttcattccctattttctaaattcttactatcttcgtatgcattattac |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41675074 |
ttgactcctcactctgcctctgcctctgcctctggtatctattcctttccttttcattccctattttctaaattcttactatcttcatatgcattattac |
41675173 |
T |
 |
| Q |
218 |
catcttctacttcaaattcttttgctaggcttattcaattcccctattcaatagccaag |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41675174 |
catcttctacttcaaattcttttgctaggcttattcaattcccctattcaatatccaag |
41675232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University