View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8341_low_16 (Length: 266)
Name: NF8341_low_16
Description: NF8341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8341_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 231
Target Start/End: Complemental strand, 36601905 - 36601687
Alignment:
| Q |
28 |
tccttaaaattgtaatgttatttcaacataagaatattacaattttaaggactatttaaaatgttaacaaattcgttcatatatcaaaatttaaatatga |
127 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601905 |
tccttaaaattgtaatgttatttcaacctaacaacattacaattttaaggactatttaaaatgttaacaaattcgttcatatatcaaaatttaaatatga |
36601806 |
T |
 |
| Q |
128 |
ttcccatagttttaaatttattcgcaatactta----tt-----------taatctgattttaatcctacgaataccgatgaatgaacgaatttgattga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601805 |
ttcccatagttttaaatttattcgcaatacttacaacttaatctcatccctaatctgattttaatcctacgaataccgatgaatgaacgaatttgattga |
36601706 |
T |
 |
| Q |
213 |
aacattacaattgcagata |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36601705 |
aacattacaattgcagata |
36601687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University