View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8341_low_23 (Length: 220)
Name: NF8341_low_23
Description: NF8341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8341_low_23 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 6 - 220
Target Start/End: Original strand, 11712593 - 11712810
Alignment:
| Q |
6 |
ataataggtaggatgtttgtatttttcttctcttcttggtaaaagcaaaacagtgtttttagcttcttaaaaaagtaatactatgttggatgtttgtatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712593 |
ataataggtaggatgtttgtatttttcttctcttcttggtaaaagcaaaacagtgtttttagcttcttaaaaaagtaatactatgttggatgtttgtatt |
11712692 |
T |
 |
| Q |
106 |
tatcttcttgttttcttgttgttgaaagtggtgaaaattagagcttggaagctagtgaaaagttggaaaaagatttgcgt---gaaaatataaacagaga |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | | |
|
|
| T |
11712693 |
tatcttcttgccttcttgttgttgaaagtggtgaaaattagagcttggaagctagtgaaaagttggaaaaagatttgtgtgaagaaaatataaacaaaca |
11712792 |
T |
 |
| Q |
203 |
aaagagaatcaatcatct |
220 |
Q |
| |
|
|||||| |||| |||||| |
|
|
| T |
11712793 |
aaagagcatcattcatct |
11712810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University