View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8343_low_12 (Length: 240)
Name: NF8343_low_12
Description: NF8343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8343_low_12 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49825336 - 49825101
Alignment:
| Q |
1 |
tttaaggttggaattacggatgggaacttaatgcataattggcgcaactatgcggtcaaaaggacatctgatgaatcaatttgtgactcttcacaacatt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49825336 |
tttaaggttgaaattacggatgggaacttaatgcataattggcgcaactatgctgtcaaaaggacatctgatgaatcaatttgtgactcttcacaacatt |
49825237 |
T |
|
| Q |
101 |
acaatgacgaatatcctgctgatctggatttgttcatagacnnnnnnnntgttgtttaaagttgagataactgatggcaacttgaagcatggatggcgta |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49825236 |
acaatggcgaatatcctgctgatctggatttgttcatagac-aaaaaaatgttgtttaaagtcgagataactgatggcaacttgaagcatggatggcgta |
49825138 |
T |
|
| Q |
201 |
actaagctgtgaagcgggtgtatgatgatgtccatct |
237 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |||| |
|
|
| T |
49825137 |
actaagttgtgaagcgggtgtctgatgatgtcgatct |
49825101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 232593 - 232658
Alignment:
| Q |
1 |
tttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
65 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
232593 |
tttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
232658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 14584782 - 14584717
Alignment:
| Q |
1 |
tttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
65 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
14584782 |
tttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
14584717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University