View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8344_low_14 (Length: 243)
Name: NF8344_low_14
Description: NF8344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8344_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 29563196 - 29563427
Alignment:
| Q |
12 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29563196 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttggc |
29563295 |
T |
 |
| Q |
112 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29563296 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
29563395 |
T |
 |
| Q |
212 |
ttgctatggctgggaaagattgtcgttgtctg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29563396 |
ttgctatggctgggaaagattgtcgttgtctg |
29563427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University