View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8344_low_9 (Length: 295)
Name: NF8344_low_9
Description: NF8344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8344_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 2 - 276
Target Start/End: Complemental strand, 7009262 - 7008988
Alignment:
| Q |
2 |
caccgacaagaaagcatggacaaagtctccaaatctaagcttatatgccgacaaatcaactgaatctgatgctggagatggccagagaccattcgtggta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
7009262 |
caccgacaagaaagcatggacaaagtctccaaatctaagcttatatgccgacaaatcaactgaatctgatcccggagatggccagagaccattcatggta |
7009163 |
T |
|
| Q |
102 |
acaataccatagtgtctctggccatcgcttcctgtgtaactgtcagtgaaggaagtaaaagcacagttgaaaccacaaatgacgaggagaataccactta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009162 |
acaataccatagtgtctctggccatcgcttccggtgtaactgtcagtgaaggaagtaaaagcacagttgaaaccacaaatgacgaggagaataccactta |
7009063 |
T |
|
| Q |
202 |
ggtatttgttgatggtgctgcagtgtccattgttggttacaactggactgagatactggaacaagaagaccgtgc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009062 |
ggtatttgttgatggtgctgcagtgtccattgttggttacaactggactgagatactggaacaagaagaccgtgc |
7008988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University