View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8346_low_2 (Length: 226)
Name: NF8346_low_2
Description: NF8346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8346_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 144 - 216
Target Start/End: Original strand, 31423694 - 31423766
Alignment:
| Q |
144 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31423694 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgt |
31423766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 31423573 - 31423628
Alignment:
| Q |
23 |
tcacggttgttttgttgttcacagattttgaggtggttgctgagtttgaatgttga |
78 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31423573 |
tcacggttgtgttgttgttcacggattttgaggtggttgctgagtttgaatgttga |
31423628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University