View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_43 (Length: 252)
Name: NF8349_high_43
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 48275444 - 48275201
Alignment:
| Q |
1 |
cataagtttaccttctacgtaatac----aattacgccataaatttcatccattttttcaaaataaaaatgagctcaaaacaattttgatagttgaacac |
96 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48275444 |
cataagtttaccttctacgtaatactacaaagtatgccataaatttcatccattttttcaaaataaaaatgagctcaaaacaattttgatagttgaacac |
48275345 |
T |
 |
| Q |
97 |
aaagatatcatcacatcacaatcacactaatttaaggacatgcgtatttgttgaggtttttagcttttttgtctaatgagttgtggaaaatggatttgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48275344 |
aaagatatcatcacatcacaatcacactaatttaaggacatgcgtatttgttgaggtttttagcttttttgtctaatgagttgtggaaaatggatttgtc |
48275245 |
T |
 |
| Q |
197 |
actcaaattgcgggcttatctttaaaatttgtcttcttattctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48275244 |
actcaaattgcgggcttatctttaaaatttgtcttcttattctt |
48275201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University