View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_52 (Length: 241)
Name: NF8349_high_52
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 225
Target Start/End: Complemental strand, 19028827 - 19028610
Alignment:
| Q |
8 |
atgaacatcttttttcacatatccgtgcaacaaatgcatttctagaatttctttcacacttaaacacacattacattatagtagcctagttgttctcata |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19028827 |
atgaacatcttttttcacatatctgtgcaacaaatgcatttctagaatttctttcacacttaaacacacattacattatagtagcctagttgttctcata |
19028728 |
T |
|
| Q |
108 |
ttatgttattttatcatcaaaacttaagggcttacaaagtgttcacaaacaacccacttaaaagattaaggcatatgttctcaattgaaattcaaatcaa |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19028727 |
ttatgttattttatcatcaaagcttaagggcttacaaagtgttcacaaacaacccacttaaaagattaaggcatatgttctcaattgaaattcaaatcaa |
19028628 |
T |
|
| Q |
208 |
ttgggaaagcgaagataa |
225 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19028627 |
ttgggaaagcgaagataa |
19028610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University