View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_53 (Length: 240)
Name: NF8349_high_53
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_53 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 29446361 - 29446597
Alignment:
| Q |
18 |
cacactctccaacttcaacagtttgcttaagcttagccattggtttctatgatcagtgatcacaaggagaatatgtagaatcagaagaagctagttagta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29446361 |
cacactctccaacttcaacagtttgcttaagcttagccattggtttctatgatcagtgatcacaaggagaatatggagaatcagaagaagctagttagta |
29446460 |
T |
|
| Q |
118 |
aagaataattaattagcg--------------cgatgagtttgacatatcagagtgtgcgattgtgtttttgacaaaaattacactttggagctcaacga |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29446461 |
aagaataattaattagcgcgtgtttgaattcacgatgagtttgacatgtcagagtgtgcgattgtgtttttgacaaaaattacactttggagctcaagga |
29446560 |
T |
|
| Q |
204 |
aatcacggtgctaccatgatatcgtcaagctcactat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446561 |
aatcacggtgctaccatgatatcgtcaagctcactat |
29446597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 207
Target Start/End: Complemental strand, 8124419 - 8124382
Alignment:
| Q |
171 |
ttttgacaaaaattacactttggagc-tcaacgaaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8124419 |
ttttgacaaaaattacactttggagcttcaacgaaatc |
8124382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University