View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_60 (Length: 229)
Name: NF8349_high_60
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_60 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 24224088 - 24223862
Alignment:
| Q |
1 |
ttttgttctcaataccatgacccagtttttcattccttataacttatatttttgtcttttaatttgtctcaagtactataggaagttgcattctcctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224088 |
ttttgttctcaataccatgacccagtttttcattccttataacttatatttttgtcttttaatttgtctcaagtactataggaagttgcattctcctttc |
24223989 |
T |
 |
| Q |
101 |
atgccattcgtttacaataatgtaaggatgaaaagcaggccttagtatgtaccccacttcacatatatataatttccctatgttgaccatctagctatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24223988 |
atgccattcgtttacaataatgtaaggatgaaaagcaggccttagtatgtaccccacttcacatatatataatttccctatgttgaccatctagctatta |
24223889 |
T |
 |
| Q |
201 |
attccctatagtactagtactattactta |
229 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
24223888 |
attccctatagta--tgtactattactta |
24223862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University