View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_64 (Length: 213)
Name: NF8349_high_64
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 50 - 192
Target Start/End: Complemental strand, 9503444 - 9503301
Alignment:
| Q |
50 |
ttcagaagttaaaactaactaaactgtactcatgagtcatgcccccacatatcctcc-actgtaatggacatttacataactattaactaatttgatgag |
148 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503444 |
ttcagaaactaaaactaactaaattgtactcatgagtcatgcccccacatatcctcccactataatggacatttacataactattaactaatttgatgag |
9503345 |
T |
 |
| Q |
149 |
tatcctcgtgtgattattgactagacatgtgatacttgtaatga |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
9503344 |
tatcctcgtatgattattgactagacatgtaatacttgtgatga |
9503301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 9503517 - 9503466
Alignment:
| Q |
5 |
tgcttagctttaatggctttgtgagctatacttcagaaattgtatttcagaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||| ||||||| |
|
|
| T |
9503517 |
tgcttagctttaatggctttgtgagctgtacttcagaagatgtacttcagaa |
9503466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 9507500 - 9507471
Alignment:
| Q |
1 |
aagttgcttagctttaatggctttgtgagc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9507500 |
aagttgcttagctttaatggctttgtgagc |
9507471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University