View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8349_high_64 (Length: 213)

Name: NF8349_high_64
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8349_high_64
NF8349_high_64
[»] chr5 (3 HSPs)
chr5 (50-192)||(9503301-9503444)
chr5 (5-56)||(9503466-9503517)
chr5 (1-30)||(9507471-9507500)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 50 - 192
Target Start/End: Complemental strand, 9503444 - 9503301
Alignment:
50 ttcagaagttaaaactaactaaactgtactcatgagtcatgcccccacatatcctcc-actgtaatggacatttacataactattaactaatttgatgag 148  Q
    |||||||  |||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||    
9503444 ttcagaaactaaaactaactaaattgtactcatgagtcatgcccccacatatcctcccactataatggacatttacataactattaactaatttgatgag 9503345  T
149 tatcctcgtgtgattattgactagacatgtgatacttgtaatga 192  Q
    ||||||||| |||||||||||||||||||| |||||||| ||||    
9503344 tatcctcgtatgattattgactagacatgtaatacttgtgatga 9503301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 9503517 - 9503466
Alignment:
5 tgcttagctttaatggctttgtgagctatacttcagaaattgtatttcagaa 56  Q
    ||||||||||||||||||||||||||| ||||||||||  |||| |||||||    
9503517 tgcttagctttaatggctttgtgagctgtacttcagaagatgtacttcagaa 9503466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 9507500 - 9507471
Alignment:
1 aagttgcttagctttaatggctttgtgagc 30  Q
    ||||||||||||||||||||||||||||||    
9507500 aagttgcttagctttaatggctttgtgagc 9507471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University