View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_high_66 (Length: 205)
Name: NF8349_high_66
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 11745907 - 11746078
Alignment:
| Q |
14 |
ataatactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgccttacccttgagcacc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11745907 |
ataacactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgcctcacccttgagcacc |
11746006 |
T |
 |
| Q |
114 |
taaatctcttgattagggacttgtattgtattccctatgaacataatgaagaatagtcgttctataatcgtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11746007 |
taaatctcttgattagggacttgtattgtattccctatgaacataatgaacaatagtcgttctataatcgtt |
11746078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University