View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_33 (Length: 358)
Name: NF8349_low_33
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 348
Target Start/End: Complemental strand, 10571052 - 10570731
Alignment:
| Q |
20 |
taattttggtgtccttgtcggggatcatgacattaaatatgttgtccatgtttgctgtgatttgaacattatattcccttttgaaaatttgttttatatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10571052 |
taattttggtgtccttgtcggggatcatgacattaaatatgttgtccatgtttgctgtgatttgaacattatattcccttttgaaaatttgttttatatg |
10570953 |
T |
|
| Q |
120 |
aattgatgtttggattgtgaaaattgaatggtaaatggtgaatctgaatgagattgatagtgactaaataggtttaaaacttgtaacatgtctcgttact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10570952 |
aattgatgtttggattgtgaaaattgaacggtaaatggtgaat------gagattgatagtgactaaataggtttaaaacttgtaacatgtctcgttgct |
10570859 |
T |
|
| Q |
220 |
ctcttgattatgtcccaatcactttgaaaaatgggacatgttacggtattattgctggacttcaaaatattgtgtctagttttttaagtttcaactttct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
10570858 |
ctcttgattatgtcccaatcactttgaaaa-tgggacatgttacggtattattgctggacttcaaaatattgtgtctagttttttaagtttcaagtaact |
10570760 |
T |
|
| Q |
320 |
atgcttagtcctcaatattctcctctctg |
348 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
10570759 |
atgcttagtcctcaatattctgctctctg |
10570731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University