View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_40 (Length: 327)
Name: NF8349_low_40
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 312
Target Start/End: Original strand, 50523412 - 50523708
Alignment:
| Q |
16 |
acatcaaagtattaatccgttttgtagactcttttctcctcgtcacataatctctttcttggagaacaacttcccccgcataaaatccgtcttgcacgaa |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50523412 |
acatcagagtattaatccgttttgtagactcttttctcctcatcacataatctctttcttggagaacaacttcccccgcataaaatccgtcttgcgcgaa |
50523511 |
T |
 |
| Q |
116 |
cacttttaccgactctggatcaatttttcatatgaaattatgttgtcttacagaccgatcgacttctgagattaaattcaaatttatactcatttcttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50523512 |
cacttttaccgactctggatcaatttttcatatgaaattatgttgtcttacagaccgatcgacttctgagattaaattcaaatttatactcatttcttct |
50523611 |
T |
 |
| Q |
216 |
tagttttaattgaaaagttatatgaagtttactaatttattgtagctgtgaaacttaatatttaaattgaccaaggctggattggaaagaagtaagt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50523612 |
tagttttaattgaaaagttatatgaagtttactaatttattgtagctgtgaaacttaatatttaaattgaccaaggctggattggaaagaagtaagt |
50523708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University