View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_43 (Length: 313)
Name: NF8349_low_43
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 296
Target Start/End: Original strand, 7329373 - 7329658
Alignment:
| Q |
12 |
attattctctaattaagataaaacacagttaaagtcctcactcttcactcgcttagttattttaatttgtgacgttgaacatggacgttaactgagtcaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
7329373 |
attagtctctaattaagataaaacacagttaaagtcctcactcttcactcgcttagttattttaattcgtgacgttgaacatggacattaactgagtcaa |
7329472 |
T |
 |
| Q |
112 |
aatgatgtagctactaagaagtcaaattgtatgatgatgtacatagaagggaaggaaatgaaaggaaactgaacattcttcttcatcatttcacatg-nn |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7329473 |
aatgacgtagctactaagaagtcaaattgtatgatgatgtgcatagaagggaaggaaatgaaaggaaactgaacattcttcttcatcatttcacaagttt |
7329572 |
T |
 |
| Q |
211 |
nnnnnnncctctactctcatcttcctctcttcattaacatattaatttttcatataacggaaaatattattgaaggatctaagaac |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7329573 |
tttttttcctctactctcatcttcctctcttcattaacatattaatttttcatataacggaaaatattattgaaggatctaagaac |
7329658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University