View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_50 (Length: 284)
Name: NF8349_low_50
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_50 |
 | |
|
| [»] scaffold0002 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 459283 - 459065
Alignment:
| Q |
17 |
atttaaaatatcaacattgaaaaatataatagtctaacctctccccattca--tgagtcaaagaaaagcttctcaccattcagatagatcttggcatctg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
459283 |
atttaaaatatcaacattgaaaaatataatagtctaacctctccccattcacatgagtcaaagaaaagcttctcaccattcagatagatcttggcatctg |
459184 |
T |
|
| Q |
115 |
accgatgaagacgtgagatttgtgtgctgatggaatggtgatgttgttgtgattatgtcattgggatgacgttagggaannnnnnnngaatgctattcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
459183 |
accgatgaagacgtgagatttgtgtgctgatggaatggtgatgttgttgtgattgtgtcattgggatgacgttagggaa-tttttttgaatgctattcaa |
459085 |
T |
|
| Q |
215 |
tttatttatactaacgtgaa |
234 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
459084 |
tttatttatactaatgtgaa |
459065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 86 - 271
Target Start/End: Complemental strand, 467852 - 467685
Alignment:
| Q |
86 |
ctcaccattcagatagatcttggcatctgaccgatgaagacgtgagatttgtgtgctgatggaatggtgatgttgttgtgattatgtcattgggatgacg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||| |||||| || |||||| |
|
|
| T |
467852 |
ctcaccattcagatagatcttggcatctgaccgttgaagacgtg---------tgctgatggaatggtgatgttgtcgtgattgtgtcataggtatgacg |
467762 |
T |
|
| Q |
186 |
ttagggaannnnnnnngaatgctattcaatttatttatactaacgtgaaaggacaatgtgaaccttccaggttgtgctgcgaatct |
271 |
Q |
| |
|
|||| || ||| ||| |||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
467761 |
ttagataaaa-------aata--atttaatttatttatattaatgtgaaaggacaatgtgaactttccaggttgtgctgcgaatct |
467685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 467890 - 467856
Alignment:
| Q |
19 |
ttaaaatatcaacattgaaaaatataatagtctaa |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
467890 |
ttaaaatatcaacattgaaaattataatagtctaa |
467856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University