View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_51 (Length: 281)
Name: NF8349_low_51
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_51 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 51489898 - 51490178
Alignment:
| Q |
1 |
tggttcaatgaatgttatcattggtgaagttggttggccaactgatggaacatcaaatgctaatataaaaagtgctcaaagatttaatcaaggacttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51489898 |
tggttcaatgaatgttatcattggtgaagttggttggccaactgatggaacatcaaatgctaatataaaaagtgctcaaagatttaatcaaggacttgtt |
51489997 |
T |
|
| Q |
101 |
gatagaatagtgaaaaagcaaggaacacctaaaagacctaccccacctgaaatttacatgtttgcccttttagatgaggatttaaaaagtattgatcctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51489998 |
gatagaatagtgaaaaagcaaggaacacctaaaagacctaccccacctgaaatttacatgtttgcccttttagatgaggatttaaaaagtattgatcctg |
51490097 |
T |
|
| Q |
201 |
gcccatttgagagacattggggaattttcaattttgatggatctatgaaataccctttgaatcttggtggtggaaaatcac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51490098 |
gcccatttgagagacattggggaattttcaattttgatggatctatgaaataccctttgaatcttggtggtggaaaatcac |
51490178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 46353595 - 46353651
Alignment:
| Q |
185 |
aaaagtattgatcctggcccatttgagagacattggggaattttcaattttgatgga |
241 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
46353595 |
aaaagtattgctcctggcaactttgagagacattggggaatttttgagtttgatgga |
46353651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University