View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_53 (Length: 275)
Name: NF8349_low_53
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 20 - 263
Target Start/End: Complemental strand, 3817220 - 3816978
Alignment:
| Q |
20 |
tatccgatgactattagtcatcgatgcctattctgttttttcgaagnnnnnnn-gttctaaacctacatgtgaatttgttttttcggttatcgatgtcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3817220 |
tatccgatgactattagtcatcgatgcctattctgttttt-cgaagttttttttgttctaaacctacatgtgaatttgttttt-cggttattgatgtcgt |
3817123 |
T |
|
| Q |
119 |
ttgcaaattttcgtttatccatatgccgtttgcaaatctttggttatcgattgcctatttgactctaatttatccatgcttttgttttctttaatattga |
218 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3817122 |
ttgtaaattttcgtttatccatgtgccgtttgcaaatctttggtcatcgattgcctatttgactctaatttatccatgcttttgttttctttaatattga |
3817023 |
T |
|
| Q |
219 |
agtgacaaacatttgtgcatttaatttcggtccttgatgtccatc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
3817022 |
agtgacaaacatttgtgcatttaatttcagtcctcgatgtccatc |
3816978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 31052194 - 31052235
Alignment:
| Q |
223 |
acaaacatttgtgcatttaatttcggtccttgatgtccatct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31052194 |
acaaacatttgtgcatttaatttcggtcctcgatgtccatct |
31052235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University