View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_55 (Length: 267)
Name: NF8349_low_55
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 169257 - 169484
Alignment:
| Q |
19 |
attacattgtctctagacccattttatagaaaaatatggtaattgtccatgcaaatatagattagttgataatgacaatacattgtaatatgtggagatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
169257 |
attacattgtctctagacccattttatagaaaaatatggtaattgtccatgcaaatatagattagttgataataacaatgcattgtaatatgtggagatt |
169356 |
T |
|
| Q |
119 |
cgaaccttaaattctctgcttatttaccataaaagtgaattataatcactaagct-----tnnnnnnnntgttaactatcacatgcatgcatgtttatca |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
169357 |
caaaccttaaattctctgcttatttaccataaaagtgaattataatcactaagctacttaaaaaaaaaatgttaactatcgcatgcatgcatgtttatca |
169456 |
T |
|
| Q |
214 |
cgttttatatattttgatattcttcgac |
241 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
169457 |
cgttttatatattttgataatcttcgac |
169484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University