View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_56 (Length: 264)
Name: NF8349_low_56
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 65 - 254
Target Start/End: Original strand, 7937611 - 7937801
Alignment:
| Q |
65 |
cttagacggctacatactgactttcttgtgaccaaatgtacttgttgccttgcttcgttttctcttcatggaat-cgattggtggtagtggtgataactt |
163 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
7937611 |
cttagacgactacgtactgactttcttgtgaccaaatgtacttgttgccatacttcgttttctcttcatgtaattcgattgctggtagtggtgataactt |
7937710 |
T |
|
| Q |
164 |
gattttaatctcatctttcacaaaagtgatgtgttggtataatcgttatataaggcacgacgataatattatcaaggccttccaagaataa |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7937711 |
gattttaatctcatccttcacaaaagtgatgtgttggtataatcgttatataaggcacgacgataatattattaaggccttccaagaataa |
7937801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 7937450 - 7937502
Alignment:
| Q |
16 |
catgtgatttttattttgaataggatatctttttacttcaaaatcaactctta |
68 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
7937450 |
catgtgatttttattttgaatatgatatttttttgcctcaaaatcaactctta |
7937502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 250
Target Start/End: Original strand, 42679209 - 42679301
Alignment:
| Q |
159 |
aacttgattttaatctcatctttcacaaaagtgatg-tgttggtataatcgttatataaggcacgacgataatattatcaaggccttccaaga |
250 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| || ||||||||||| | | |||||| |||||| ||| ||||| || ||||| |||||| |
|
|
| T |
42679209 |
aacttgattttaataccatatttcacaaaagtgttgatgttggtataaccatcatataatgcacgatgatcatattgccatggcctcccaaga |
42679301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University