View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8349_low_57 (Length: 264)

Name: NF8349_low_57
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8349_low_57
NF8349_low_57
[»] chr7 (1 HSPs)
chr7 (1-244)||(22180285-22180528)


Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 22180528 - 22180285
Alignment:
1 ggtgattgattatatagtgtctgttgtattgcctgctgatgcggaactggcagtatctcaagattcgaagatgggtttgaagaagaggtttcaagagagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22180528 ggtgattgattatatagtgtctgttgtattgcctgctgatgcggaactggcagtatctcaagattcgaagatgggtttgaagaagaggtttcaagagagt 22180429  T
101 ttggtgtggttgcaatggttgatgtttgaggatgaccctggaaatgctttgagacacctttctagtatggttggtcagggaggtgtttgtggggcagttt 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||    
22180428 ttggtgtggttgcaatggttgatgtttgaggatgacccgggaaatgctttgagacgcctttctagtatggttggtcagggaggtgtttgcggggcggttt 22180329  T
201 ggggacgtaccgatattgcttataggtgtaggacttgtgaacat 244  Q
    |||||||||| |||||||||||||||||||||||||||||||||    
22180328 ggggacgtactgatattgcttataggtgtaggacttgtgaacat 22180285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University