View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_59 (Length: 254)
Name: NF8349_low_59
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 6 - 237
Target Start/End: Complemental strand, 49484386 - 49484155
Alignment:
| Q |
6 |
gaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaacaatccaggatgctatggagatcaatcct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
49484386 |
gaaaatcaacttgataagctcggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaaacaattgaggatgctattgagacagatcct |
49484287 |
T |
|
| Q |
106 |
gctggtgatatcaatagcatttctctttctttagtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcacaagaacacacaaatgtcag |
205 |
Q |
| |
|
|||||||| | ||| | ||||||||||||||||||| |||| || | ||| ||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49484286 |
actggtgatgttaattgtatttctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcag |
49484187 |
T |
|
| Q |
206 |
atgttgatctcaaggattaggatgttgaattc |
237 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |
|
|
| T |
49484186 |
atgttgatctcatggattgggatgttgaattc |
49484155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 55072058 - 55072131
Alignment:
| Q |
3 |
aaagaaaatcaacttgataagctcggatggggatgtgtttgaagttgattacgatgttgcacttatgtcaaaaa |
76 |
Q |
| |
|
||||||| |||||||| |||||||||| |||| ||||||||||||||||| | | | |||||||||||||||| |
|
|
| T |
55072058 |
aaagaaagtcaacttggtaagctcggacggggttgtgtttgaagttgatttgggtttggcacttatgtcaaaaa |
55072131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 55072199 - 55072247
Alignment:
| Q |
138 |
agtgaatagcgaattgttgaccaaggtcattgaatactgcaagaagcac |
186 |
Q |
| |
|
|||||||||| || |||||| || |||| |||||||||||||||||||| |
|
|
| T |
55072199 |
agtgaatagcaaaatgttgagcatggtcgttgaatactgcaagaagcac |
55072247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University