View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_68 (Length: 242)
Name: NF8349_low_68
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 225
Target Start/End: Complemental strand, 43503293 - 43503071
Alignment:
| Q |
3 |
gaagtctctccatgttgaagaacgttcctggaaatgtaactgagtatatcgaaagtgtcgtctcccccaaaactcccaaaactcccaagactcctagaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43503293 |
gaagtctctccatgttgaagaacgttcctggaaatgtaactgagtatattgaaagtgtcgtctccccaaaaactcccaaaactcccaagactcctagaag |
43503194 |
T |
|
| Q |
103 |
taattttcttgatcaggaactataaatctatgaagtgatactccaacaaaaattgggggacttgacatggaagctgcctaacgtattttacttaaggaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43503193 |
taattttcttgatcaggaactataaatctatgaagtgatactccaacaaaaattgggggacttgacatggaagctgcctaacgtattttacttaaggaga |
43503094 |
T |
|
| Q |
203 |
gtggatggtaacataatttaatt |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43503093 |
gtggatggtaacataatttaatt |
43503071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University