View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_70 (Length: 241)
Name: NF8349_low_70
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 24223827 - 24223602
Alignment:
| Q |
1 |
taagttgaaattactaatctttgaatggagtctgatcaacatgataaaggtggtgatgatcaagatgcaaaacaagtaaaccctagatcctatgagtgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24223827 |
taagttgaaattactaatctttgaatggagtctgatcaacatgataaaggtggtgatgatcaagatgcaaaacaagtaaaccctagatcctatgagtgca |
24223728 |
T |
 |
| Q |
101 |
atttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagataaagcaaagctcaaacaacaatcttcaacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24223727 |
atttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagataaagcaaagctcaaacaacaatcttcaacaaa |
24223628 |
T |
 |
| Q |
201 |
ttaccaaacccaattaccatctaatt |
226 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
24223627 |
ttaccaaactcaattaccatctaatt |
24223602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 23010963 - 23010871
Alignment:
| Q |
102 |
tttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagataaagcaaagctcaaacaacaatcttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || || ||||||||||| ||||| | ||||| ||| |||||||||||||||||||| |
|
|
| T |
23010963 |
tttttgcaagagaggattctctaatgcacaagcattaggaggccacatgaatatccatagaagagatagagccaagctcaaacaacaatcttc |
23010871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 169
Target Start/End: Original strand, 33406374 - 33406440
Alignment:
| Q |
103 |
ttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagata |
169 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||| | ||||| ||||||||||||||||||||||||| |
|
|
| T |
33406374 |
ttttgcaaaagaggattcacaaatgcacaagctttaggtggtcacatgaatattcataggaaagata |
33406440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 176
Target Start/End: Complemental strand, 30956749 - 30956657
Alignment:
| Q |
84 |
tagatcctatgagtgcaatttttgcaagagaggattctctaatgcacaagctcttggtggacacatgaatattcataggaaagataaagcaaa |
176 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||| | | ||| |||||| | |||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
30956749 |
tagatcctatgagtgtgtgttttgcaaaagaggtttcacaactgctcaagctttaggtggacacatgaacattcatagaaaagatagagcaaa |
30956657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 130 - 186
Target Start/End: Original strand, 34522639 - 34522695
Alignment:
| Q |
130 |
caagctcttggtggacacatgaatattcataggaaagataaagcaaagctcaaacaa |
186 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| ||| | |||||||||| |
|
|
| T |
34522639 |
caagctcttggtggtcacatgaatattcataggagagatagagctaggctcaaacaa |
34522695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University