View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_75 (Length: 240)
Name: NF8349_low_75
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_75 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0049 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 64033 - 63820
Alignment:
| Q |
8 |
tcatgatacttgcttaattcaca-cttgcattgacttagaatgacactgctcgctctctgagcttctgactgtgtttcaatttctcattcgactatgagt |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
64033 |
tcatgatacttgcttaattcacaacttgcattgacttggaatgacactgctcgctatctgagcttctgactgtgtttcaatttctcattcgactatgagt |
63934 |
T |
 |
| Q |
107 |
ttttgactctgattttcattactgggatgcaatgttcatagcaatatgtcatcatcatcctttatgtagtaatctatgaagattaggtgtgttccggtgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
63933 |
ttttgactctgattttcattactgggatgcaatgttcatagcaatatgtcatcatcatcctttatgtagtaatctatgaagattaggtgtgttccggtgt |
63834 |
T |
 |
| Q |
207 |
ctgacaccgacact |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
63833 |
ctgacaccgacact |
63820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University