View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_77 (Length: 237)
Name: NF8349_low_77
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 2662895 - 2663104
Alignment:
| Q |
11 |
gtgagatgaatatgacctcattcttgaattcttgcaagccttgtccagaattctccgagagccttttcactgctatttcttgtccagatggaagctggcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2662895 |
gtgagatgaatatgacctcattcttgaattcttgcaagccttgtccagaattctccgagagccttttcactgctatttcttgtccagatggaagctggcc |
2662994 |
T |
|
| Q |
111 |
ctaaaagttacaacagatccaagatattatcatagttgttgtaaaactaagagggtaagtagctttggtaccttttcttgatggaaaaatcaaccaaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2662995 |
ctaaaagttacaacagatccaagatattatcatagttgttgtaaaactaagagggtaagtagctttggtaccttttcttgatggaaaaatcaaccaaact |
2663094 |
T |
|
| Q |
211 |
tactaaaact |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
2663095 |
tactaaaact |
2663104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 3979461 - 3979525
Alignment:
| Q |
28 |
tcattcttgaattcttgcaagccttgtccagaattctccgagagccttttcactgctatttcttg |
92 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||| |||| || ||||||||||| ||||| ||||| |
|
|
| T |
3979461 |
tcatttttgaattcctgcaacccttgtccagacttctttgaaagccttttcacagctatctcttg |
3979525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University