View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_84 (Length: 217)
Name: NF8349_low_84
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 6353358 - 6353540
Alignment:
| Q |
15 |
agcagagacggtaagctgttttgacagtataagctccacccaccgttgacttccagattcgagaatcagttcttgatcgagcaaatagtggaatggacag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353358 |
agcagagacggtaagctgttttgacagtataagctccacccaccgttgacttccagattcgagaatcagttcttgatcgagcaaatagtggaatggacag |
6353457 |
T |
 |
| Q |
115 |
aattgtggttacatcagtagcatcaaacagattttgtatgacaggaatgttccaagaattcagacccgggtttagcaaagcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353458 |
aattgtggttacatcagtagcatcaaacagattttgtatgacaggaatgttccaagaattcagacccgggtttagcaaagcat |
6353540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 103 - 197
Target Start/End: Original strand, 23601120 - 23601214
Alignment:
| Q |
103 |
tggaatggacagaattgtggttacatcagtagcatcaaacagattttgtatgacaggaatgttccaagaattcagacccgggtttagcaaagcat |
197 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23601120 |
tggaatggacagaatttctgttacatcaatagcatcaaacaaattttgtatgacagaaatgttccaagaattcagactcgggtttagcaaagcat |
23601214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University