View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_87 (Length: 211)
Name: NF8349_low_87
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 176
Target Start/End: Original strand, 28291222 - 28291384
Alignment:
| Q |
14 |
gtgagatgaagatgaatacaactctggagtttgctgcaagttatacagacgttgttgcccaagtaaagttgccatgtcagggtagggtcccgacgtaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
28291222 |
gtgagatgaagatgaatacaactctggagtttgctgcaagttatacagacgttgttgcccaagtaaagtttccatgtcagggtagggttccgacgtaaga |
28291321 |
T |
|
| Q |
114 |
catggacttatatgaattgtcacgtcagggtgttgacgctgtgcatccgaattaatggtcacc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28291322 |
catggacttatatgaattgtcacgtcagggtgttgacgctgtgcatccgaattaatggtcacc |
28291384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University