View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8349_low_88 (Length: 205)

Name: NF8349_low_88
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8349_low_88
NF8349_low_88
[»] chr5 (1 HSPs)
chr5 (14-185)||(11745907-11746078)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 11745907 - 11746078
Alignment:
14 ataatactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgccttacccttgagcacc 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
11745907 ataacactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgcctcacccttgagcacc 11746006  T
114 taaatctcttgattagggacttgtattgtattccctatgaacataatgaagaatagtcgttctataatcgtt 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
11746007 taaatctcttgattagggacttgtattgtattccctatgaacataatgaacaatagtcgttctataatcgtt 11746078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University