View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8349_low_89 (Length: 203)

Name: NF8349_low_89
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8349_low_89
NF8349_low_89
[»] chr1 (2 HSPs)
chr1 (108-186)||(48216167-48216245)
chr1 (14-52)||(48216069-48216107)
[»] chr2 (1 HSPs)
chr2 (110-182)||(38614490-38614563)
[»] chr4 (1 HSPs)
chr4 (117-174)||(43389251-43389309)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 48216167 - 48216245
Alignment:
108 tagtgatgggcttttggattttaaaaataagcttgtgctttcttcatgccttcgattccaatcaaaattgggtaataat 186  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
48216167 tagtgattggcttttggattttaaaaataaccttgtgctttcttcatgccttcgattccaatcaaaattgggtaataat 48216245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 48216069 - 48216107
Alignment:
14 taatactcatattgatatgggtttcatggatgttgaatc 52  Q
    |||| |||||||||||||| |||||||||||||||||||    
48216069 taattctcatattgatatgagtttcatggatgttgaatc 48216107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 110 - 182
Target Start/End: Complemental strand, 38614563 - 38614490
Alignment:
110 gtgatgggcttttggattttaaaaataagcttgtgctttcttcatgcc-ttcgattccaatcaaaattgggtaa 182  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
38614563 gtgattggcttttggatttgaaaaataagcttgtgctttcttcatgcctttcgattccaatcaaaactgggtaa 38614490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 43389251 - 43389309
Alignment:
117 gcttttggattttaaaaataagcttgtgctttcttcatgcc-ttcgattccaatcaaaa 174  Q
    |||| ||||||| ||||||||||||||||||||||| |||| ||| ||||| |||||||    
43389251 gcttgtggatttgaaaaataagcttgtgctttcttcgtgccattcaattccgatcaaaa 43389309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University