View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_89 (Length: 203)
Name: NF8349_low_89
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 48216167 - 48216245
Alignment:
| Q |
108 |
tagtgatgggcttttggattttaaaaataagcttgtgctttcttcatgccttcgattccaatcaaaattgggtaataat |
186 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48216167 |
tagtgattggcttttggattttaaaaataaccttgtgctttcttcatgccttcgattccaatcaaaattgggtaataat |
48216245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 48216069 - 48216107
Alignment:
| Q |
14 |
taatactcatattgatatgggtttcatggatgttgaatc |
52 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
48216069 |
taattctcatattgatatgagtttcatggatgttgaatc |
48216107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 110 - 182
Target Start/End: Complemental strand, 38614563 - 38614490
Alignment:
| Q |
110 |
gtgatgggcttttggattttaaaaataagcttgtgctttcttcatgcc-ttcgattccaatcaaaattgggtaa |
182 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
38614563 |
gtgattggcttttggatttgaaaaataagcttgtgctttcttcatgcctttcgattccaatcaaaactgggtaa |
38614490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 43389251 - 43389309
Alignment:
| Q |
117 |
gcttttggattttaaaaataagcttgtgctttcttcatgcc-ttcgattccaatcaaaa |
174 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||| |||| ||| ||||| ||||||| |
|
|
| T |
43389251 |
gcttgtggatttgaaaaataagcttgtgctttcttcgtgccattcaattccgatcaaaa |
43389309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University