View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8349_low_90 (Length: 201)
Name: NF8349_low_90
Description: NF8349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8349_low_90 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 2 - 189
Target Start/End: Complemental strand, 38891891 - 38891699
Alignment:
| Q |
2 |
tatatgtaccattttcaatggagatgaagattgttggtattagttgaaaaatatatgttgaagaagtctcacattac---gtattataaaggaaaaggaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
38891891 |
tatatgtaccattttcaatggagatgaagattgttggtgttagttgaaaaatatatgttgaagaagtctcacattacctagtattataaaggaaaaggga |
38891792 |
T |
|
| Q |
99 |
ggttgggactatatatat--ggactataattttttgttatatgacacactagccaaaaacacattaaacttctatggaactttttcttttctt |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
38891791 |
ggttgggactatatatatatggactataattttttgttatatgacacactagccaaaaacacattaaacttgtatggaattttttcttttctt |
38891699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University