View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_high_10 (Length: 363)
Name: NF8350_high_10
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 6e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 169 - 278
Target Start/End: Complemental strand, 36398121 - 36398012
Alignment:
| Q |
169 |
agcagctagctgattaatacgttaatgttccacttcacctggagaatttagaccttcatgctcagttcaggtagcttgtttacttgatgcaatgatgcct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36398121 |
agcagctagctgattaatacgttaatgttccacttcacctggagaattaagaccttcatgctcagttcaggtagcttgtttacttgatgcaatgatgcct |
36398022 |
T |
|
| Q |
269 |
atatattcaa |
278 |
Q |
| |
|
|||||||||| |
|
|
| T |
36398021 |
atatattcaa |
36398012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 105
Target Start/End: Complemental strand, 36399025 - 36398931
Alignment:
| Q |
11 |
agttcttctcaatcatatgtgattggtgaattaatacatgtcattcttaaagtttctatttcctcctttaatttttcatgatcataaaagtgaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36399025 |
agttcttctcaatcatatgtgattggtgaattaatacatgtcattcttaaagtttctatttcctcctttaatttttcatgatcataaaagtgaat |
36398931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 275 - 349
Target Start/End: Complemental strand, 36397969 - 36397895
Alignment:
| Q |
275 |
tcaatgaattgcaaattaagcatattgctattcttcttttttattcaattaatctcaagttttggatcagtataa |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36397969 |
tcaatgaattgcaaattaagcatattgctattcttcttttttagtcaattaatctcaagttttggatcagtataa |
36397895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University