View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_high_28 (Length: 221)
Name: NF8350_high_28
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 5461367 - 5461160
Alignment:
| Q |
1 |
tttgttggcatctttagagacccgtgagggtgttcgtattgggactgtgagtgcccttgctttgttctatcccacattagggtggatacttctcgatcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461367 |
tttgttggcatctttagagacccgtgagggtgttcgtattgggactgtgagtgcccttgctttgttctatcccacattagggtggatacttctcgatctg |
5461268 |
T |
 |
| Q |
101 |
agacctgaaggttgataggagtatatctctaacatatcaactgatatctgattaatttcacattttatctacatgttctatttgataatcattttcgttc |
200 |
Q |
| |
|
| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| || || ||||| ||||||| ||||||| || |
|
|
| T |
5461267 |
aaacctaaaggttgataggagtatatctttaacatatcaactgatatctgattaatgtcaaattttatacacgtgatctatgtgataataattttcgatc |
5461168 |
T |
 |
| Q |
201 |
taacgata |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
5461167 |
taacgata |
5461160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University