View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_high_32 (Length: 207)
Name: NF8350_high_32
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 36399015 - 36399181
Alignment:
| Q |
13 |
tgagaagaactgcggtggtagtggatgatacatgtgatttcctttttggttgatagatattttaccaaaggaagacattctatctaatctatctatctac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36399015 |
tgagaagaactgcggtggtagtggatgatacatgtgatttcctttttggttgatagatattttaccaaaggaagacattct-----atctatctatctac |
36399109 |
T |
 |
| Q |
113 |
catatatgttatttatgtggacacttgagatgatgtgtcccgtgtcggcaacaagtccttttcaatattagc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36399110 |
catatatgttatttatgtggacacttgagatgatgtgtcccgtgtcggcaacaagtccttttcaatattagc |
36399181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University