View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_low_16 (Length: 341)
Name: NF8350_low_16
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_low_16 |
 | |
|
| [»] scaffold0366 (1 HSPs) |
| |
|
| [»] scaffold0459 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0366 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 12 - 341
Target Start/End: Complemental strand, 7858 - 7529
Alignment:
| Q |
12 |
agttcctaaagagggggatccaacattggataaataccaatttcattggttgtatgcaaatggattgctaggaattatattcactttttgccttctctat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7858 |
agttcctaaagagggggatccaacattggataaataccaatttcattggttgtatgcaaatggattgctaggaattatattcactttttgccttctctat |
7759 |
T |
|
| Q |
112 |
acttctttgaaaagcagaagagcaaggtcatggttatatggaacaggtttgtcaagaaaactcttggtgataatttgaggttttgagccatcattagtgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7758 |
acttctttgaaaagcagaagagcaaggtcatggttatatggaacaggtttgtcaagaaaactcttggtgataatttgaggctttgagccatcattagtgg |
7659 |
T |
|
| Q |
212 |
atttggattcagccacatcttggactgcccatattttaatttcttttaaaaatatcgaacttgaagtatagactgtccaattttgatcgtacagtccaga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
7658 |
atttggattcagccacatcttggactgcccatattttaatttcttttaaaaatatcgaacttgaagtatcgactgtccaattttgatccgacagtccaga |
7559 |
T |
|
| Q |
312 |
tgtgggcatctatatgcagtcatgaggttg |
341 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
7558 |
tgtggccatctatatgcagtcatgaggttg |
7529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 12 - 341
Target Start/End: Complemental strand, 7862 - 7533
Alignment:
| Q |
12 |
agttcctaaagagggggatccaacattggataaataccaatttcattggttgtatgcaaatggattgctaggaattatattcactttttgccttctctat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7862 |
agttcctaaagagggggatccaacattggataaataccaatttcattggttgtatgcaaatggattgctaggaattatattcactttttgccttctctat |
7763 |
T |
|
| Q |
112 |
acttctttgaaaagcagaagagcaaggtcatggttatatggaacaggtttgtcaagaaaactcttggtgataatttgaggttttgagccatcattagtgg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7762 |
acttctttgaaaagcagaaaagcaaggtcatggttatatggaacaggtttgtcaagaaaactcttggtgataatttgaggctttgagccatcattagtgg |
7663 |
T |
|
| Q |
212 |
atttggattcagccacatcttggactgcccatattttaatttcttttaaaaatatcgaacttgaagtatagactgtccaattttgatcgtacagtccaga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
7662 |
atttggattcagccacatcttggactgcccatattttaatttcttttaaaaatatcgaacttgaagtatcgactgtccaattttgatccgacagtccaga |
7563 |
T |
|
| Q |
312 |
tgtgggcatctatatgcagtcatgaggttg |
341 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
7562 |
tgtggccatctatatgcagtcatgaggttg |
7533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University